Review



pmscv ires egfp backbone  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Addgene inc pmscv ires egfp backbone
    Pmscv Ires Egfp Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 155 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmscv+egfp/MIGR1+(Plasmid+%2327490)/pmc12785237-138-17-19
    Average 95 stars, based on 155 article reviews
    pmscv ires egfp backbone - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: An Evolutionarily Conserved AU-Rich Element in the 3' Untranslated Region of a Transcript Misannotated as a Long Noncoding RNA Regulates RNA Stability.
    Article Snippet: .. The insert was amplified from the pMSCV-EGFP-Bulged-miR-19 vector (Addgene #91976) (primers AATTCTCGAGCTGGTTAACGACGGGTCC and AATTGCGGCCGCGTCGTTTAA ACGTCGGGA) and was cloned into psiCHECK2 using the restriction enzymes XhoI and NotI (New England Biolabs). .. Ligation was performed with T4 DNA Ligase (New England Biolabs) and ligation products were subsequently transformed into DH5a competent E. coli (Thermo Fisher Scientific).

    Clone Assay:

    Article Title: An Evolutionarily Conserved AU-Rich Element in the 3' Untranslated Region of a Transcript Misannotated as a Long Noncoding RNA Regulates RNA Stability.
    Article Snippet: .. The insert was amplified from the pMSCV-EGFP-Bulged-miR-19 vector (Addgene #91976) (primers AATTCTCGAGCTGGTTAACGACGGGTCC and AATTGCGGCCGCGTCGTTTAA ACGTCGGGA) and was cloned into psiCHECK2 using the restriction enzymes XhoI and NotI (New England Biolabs). .. Ligation was performed with T4 DNA Ligase (New England Biolabs) and ligation products were subsequently transformed into DH5a competent E. coli (Thermo Fisher Scientific).



    Similar Products

    pmscv mll enl ires egfp vector  (New England Biolabs)
    99
    New England Biolabs pmscv mll enl ires egfp vector
    Pmscv Mll Enl Ires Egfp Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmscv+egfp/BglII/bio_rxiv__2025__07__18__665518-162-10-26
    Average 99 stars, based on 1 article reviews
    pmscv mll enl ires egfp vector - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    pmscv ires egfp backbone  (Addgene inc)
    95
    Addgene inc pmscv ires egfp backbone
    Pmscv Ires Egfp Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmscv+egfp/MIGR1+(Plasmid+%2327490)/pmc12785237-138-17-19
    Average 95 stars, based on 1 article reviews
    pmscv ires egfp backbone - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    pmscv loxp  (Addgene inc)
    93
    Addgene inc pmscv loxp
    Pmscv Loxp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmscv+egfp/pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE+(Plasmid+%2332702)/pmc12766950-451-7-8
    Average 93 stars, based on 1 article reviews
    pmscv loxp - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    step pcr  (Addgene inc)
    93
    Addgene inc step pcr
    Step Pcr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmscv+egfp/pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE+(Plasmid+%2332702)/pmc11997551-36-37-33
    Average 93 stars, based on 1 article reviews
    step pcr - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    attb1 b2 recombination sites  (Addgene inc)
    93
    Addgene inc attb1 b2 recombination sites
    Attb1 B2 Recombination Sites, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmscv+egfp/pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE+(Plasmid+%2332702)/pmc11997551-36-12-29
    Average 93 stars, based on 1 article reviews
    attb1 b2 recombination sites - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    pmscv ires egfp addgene  (Addgene inc)
    95
    Addgene inc pmscv ires egfp addgene
    Pmscv Ires Egfp Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmscv+egfp/MSCV-IRES-GFP+(Plasmid+%2320672)/pm40101708-279-139-141
    Average 95 stars, based on 1 article reviews
    pmscv ires egfp addgene - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    pmscv ires egfp  (Addgene inc)
    95
    Addgene inc pmscv ires egfp
    Pmscv Ires Egfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmscv+egfp/MSCV-IRES-GFP+(Plasmid+%2320672)/pm40101708-287-29-31
    Average 95 stars, based on 1 article reviews
    pmscv ires egfp - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier

    Image Search Results